Skip to main content
Download PDF

Cloning and functional analysis of the molting gene CYP302A1 of Daphnia sinensis

Frontiers in Zoology volume 20, Article number: 2 (2023) Cite this article

Abstract

Background

Molting is an important physiological process in the growth and development of arthropoda, which is mainly regulated by juvenile hormone and ecdysone. CYP302A1 is a key enzyme which plays a critical role in the synthesis of ecdysone in insects, but it has not been identified in cladocera.

Results

The CYP302Al gene of Daphnia sinensis was cloned and its function was analyzed in this paper. The CYP302Al gene of D. sinensis was 5926 bp in full-length, with an open reading frame (ORF) of 1596 bp that encoded 531 amino acids (aa), a molecular weight of 60.82 kDa and an isoelectric point of 9.29. The amino acid sequence analysis revealed that there were five characteristic conserved regions of cytochrome P450 family (namely helix-C, helix-K, helix-I, PERF and heme-binding). In dsRNA mediated experiment, the expression level of CYP302A1 gene decreased significantly (knock-down of 56.22%) in the 5% Escherichia coli concentration treatment. In addition, the expression levels of EcR and USP and HR3 genes in the downstream were also significantly decreased, whereas that of FTZ-f1 gene increased significantly. In the 5% E. coli treatment, the molting time at maturity of D. sinensis prolonged, and the development of embryos in the incubation capsule appeared abnormal or disintegrated. The whole-mount in situ hybridization showed that the CYP302A1 gene of D. sinensis had six expression sites before RNA interference (RNAi), which located in the first antennal ganglion, ovary, cecae, olfactory hair, thoracic limb and tail spine. However, the expression signal of the CYP302A1 gene of D. sinensis disappeared in the first antennal ganglion and obviously attenuated in the ovary after RNAi.

Conclusion

The CYP302A1 gene played an important role in the ecdysone synthesis pathway of D. sinensis, and the knock-down of the gene affected the molting and reproduction of D. sinensis.

Background

During the life history of cladocera (e.g. Daphnia), their growth and molting are alternately [1]. The molting action runs through their whole life cycle, and it is a necessary step before they grow and reproduce [2]. Molting is a result of long-term evolution in arthropod, which are regulated by many factors [3]. In crustacean ecdysis, ecdysteroid is the most important regulatory factor, which the expression levels vary among species [4]. Among ecdysones, 20-hydroxyecdysone (20E) is one of the more active hormones in insects [5]. Moreover, ecdysone can not only regulate the molting physiology in arthropods, but also plays important roles in their growth, reproduction and phenotypic plasticity [6,7,8,9,10].

The synthetic pathway of ecdysone has been extensively studied in insects [11, 12]. Usually, the synthesis of insect ecdysone is divided into two stages. Firstly, the cholesterol in food was digested and absorbed through the intestine, and then transported to the prothymus (PG) by hemolymph. The cholesterol was transformed to 5β-diketol (3D2, 22, 25dE) under the catalysis of both Neverland and CYP307A1 gene [13,14,15]. Secondly, the 5β-diketol was converted to inactive ecdysterone catalyzed by various cytochrome P450s (CYP306Al, CYP302Al, and CYP315Al) [16,17,18,19]. The inactive ecdysone could be also converted to 20 E under the catalysis of the CYP314A1 gene [20]. Among them, the CYP307A1 (Spook, Spo), CYP306A1 (Phantom, Phm), CYP302A1 (Disembodied, DIB), CYP315A1 (Shadow, Sad) and CYP314A1 (Shade, Shd) genes are referred to as the Halloween genes. The 20E mediates its biological activities through the ecdysone receptor (EcR) complex, a heterodimer consisting of two nuclear hormone receptors, EcR and the retinoid X receptor homologue Ultraspiracle (USP) [21]. It can regulate the downstream primary genes (E75, Br-C, E74 and E93) [22] and secondary response genes (HR3, HR4, HR38 and E78), and then regulate the expressions of terminal genes through FTZ-f1 gene [23]. In Drosophila, the transcript levels of Phm and DIB dropped significantly with the loss of FTZ-f1 function in PG cells [24]. In Daphnia magna, the Neverland, CYP314A1 and CYP307A1 genes had been identified, and their functions had been analyzed [25,26,27]. However, the gene expression and functional analysis of CYP302A1, CYP306A1 and CYP315A1 in cladocera (including Daphnia) have not been explored.

As one of the key genes in insect ecdysone synthesis, CYP302A1 that can catalyze the carbon-22 hydroxylase is a member of the mitochondrial cytochrome P450 family [28,29,30,31]. Chavez et al. (2000) found that inactive ecdysone and 20E had lower titers in the CYP302A1 (DIB) mutant embryos of Drosophila, and two 20E-inducible genes (IMP-E1 and L1) failed to express in some tissues, resulting in anaphase abnormality in morphology [13]. After RNAi in Sogatella furcifera and Laodelphax striatellus, the expression levels of both CYP302A1 gene and ecdysone receptor (EcR) gene decreased significantly and the development and death time of nymphs delayed [31]. In spatio-temporal expression profiling of Bombyx mori, CYP302A1 gene showed a higher expression in the ovary, testis and head of the larvae [32]. A few investigations have reported on the genes related to the ecdysone synthesis pathway of Cladocera [25,26,27, 33], but the molecular mechanisms of ecdysone synthesis pathway and ecdysone signal transduction pathway need still to be further revealed.

The study on molecular biology of Daphnia species has become a hot spot, with the successive reports on the genome of Daphnia pulex and D. magna [34, 35]. In this study, based on the transcriptome, real-time PCR and RNAi technologies, the CYP302A1 gene cloning, and the changes of downstream response gene expressions and individual phenotypic characteristics after knock-down of the gene were analyzed in D. sinensis. Meanwhile, the function of the CYP302A1 gene was discussed. Moreover, the expression sites of the CYP302A1 gene in D. sinensis was also detected by whole mount in situ hybridization technique. Our results will help to clarify the ecdysone synthesis pathway of Daphnia species, and provide a reference for the future study of ecdysis-related signaling pathways.

Results

Sequence and phylogenetic analysis of CYP302A1 gene

The full-length of the CYP302A1 gene in D. sinensis is 5926 bp with the open reading frame (ORF) of 1596 bp, which encodes 531 amino acids. The molecular formula of its protein is C2743H4344N750O778S17, with a molecular weight of 60.82 kDa and an isoelectric point of 9.29. Moreover, there is no signal peptide sequence and transmembrane domain in the CYP302A1 gene. Compared with other arthropods, the CYP302A1 gene of D. sinensis had the highest homology with Tigriopus japonicus (45.99%). In the amino acid sequence of the CYP302A1 gene, there were five characteristic conserved domains (namely, helix-C, helix-K, helix-I, PERF and heme binding) (Fig. 1). The phylogenetic tree indicated that D. sinensis was the closely related to the two other Daphnia species D. magna and D. pulex, followed by Tetranychus cinnabarinus (Fig. 2).

Fig. 1
figure 1

Homology comparison of amino acid sequences of the CYP302A1 gene in D. sinensis with other arthropods. Note: Underlines are the conserved domain of helix-C, helix-I, helix-K, PERF and heme binding

Full size image
Fig. 2
figure 2

Phylogenetic trees of the CYP302A1 gene in D. sinensis

Full size image

Induced expression of dsRNA

Usually, the expression fragments of empty body, L4440-EGFP (Enhanced Green Fluorescent Protein) recombinant plasmid and L4440-DIB recombinant plasmid induced by IPTG are 163 bp, 913 bp and 983 bp, respectively. 1% Agarose gel electrophoresis showed that the L4440 vector plasmid and L4440-EGFP were about 150 bp and 900 bp in size, respectively (Fig. 3A), and the L4440-DIB recombinant plasmid was about 1000 bp (Fig. 3B). Therefore, these results were consistent with the expected lengths of the plasmids.

Fig. 3
figure 3

Induced expression of L4440-DIB and L4440-EGFP fragments. A Induced expression levels of HT115 strain carrying L4440-EGFP recombinant plasmid and L4440 vector plasmid; B induced expression level of HT115 strain carrying l4440-DIB recombinant plasmid; M: DNA molecular weight standard; 1: HT115 strain carrying L4440 vector plasmid was not induced; 2: induced product of HT115 strain carrying L4440 vector plasmid; 3: HT115 strain carrying l4440-EGFP recombinant plasmid was not induced; 4: induced product of HT115 strain carrying l4440-EGFP recombinant plasmid; 5: HT115 strain carrying l4440-DIB recombinant plasmid was not induced; 6: Induced product of HT115 strain carrying l4440-DIB recombinant plasmid

Full size image

mRNA expression of the CYP302A1 gene after RNAi

Compared with the control treatment, the mRNA expression levels of the CYP302A1gene of D. sinensis in the 5% and 10% E. coli treatments decreased by 68.34% and 23.32%, respectively (Figs. 4, 5). Under the 5% E. coli concentration, the expression levels of EcR, USP and HR3 genes in the downstream decreased significantly, whereas the expression levels of FTZ-f1 gene increased significantly (Fig. 4). Under the 10% E. coli concentration, there was no significant difference between E10-DIB treatment and E10-EGFP treatment. Moreover, the expression levels of USP and HR3 genes in the downstream decreased whereas that of the FTZ-f1 gene increased, however, no significant differences were observed (Fig. 5). These results indicated that the dsRNA-DIB containing 5% E. coli concentration inhibited significantly the expression level of the CYP302A1 gene in D. sinensis whereas the interference efficiency was low under higher E. coli concentration (10%).

Fig. 4
figure 4

qPCR results of ecdysis gene CYP302A1 and its downstream response gene in D. sinensis fed by 5% E. coli concentration. Note: E5-EGFP: 5% E. coli concentration containing L4440-EGFP; E5-DIB: 5% E. coli concentration containing L4440-DIB. *stands for P < 0.05; **stands for P < 0.01. EcR: ecdysone receptor; USP: Ultraspiracle; E75: ecdysone-induced protein 75, which is a nuclear hormone receptor; HR3: hormone receptor 3; FTZ-f1: Fushi-tarazu factor 1, which is an ecdysone-inducible transcription factor. All these genes respond to the regulation of 20-hydroxyecdysone

Full size image
Fig. 5
figure 5

qPCR results of ecdysisgeneCYP302A1 and its downstream response gene in D. sinensis fed by 10% E. coli concentration. Note: E10-EGFP: 10% E. coli concentration containing L4440-EGFP; E10-DIB: 10% E. coli concentration containing L4440-DIB

Full size image

Phenotypic changes of D. sinensis after RNAi

Both no. eggs at first brood and no. offspring at first reproduction of D. sinensis in the E5-EGFP treatment were bigger than those in the E5-DIB treatment. However, no. eggs at first brood of D. sinensis at the 12th day of the experiment in the E5-EGFP treatment was significantly bigger than one in the E5-DIB treatment (Fig. 6). The molting time at first brood of D. sinensis in the E5-EGFP treatment were shorter than those in the E5-DIB treatment as well as the molting time at first reproduction (Fig. 6).

Fig. 6
figure 6

No. offspring at first reproduction, and no. eggs and molting time at two growth stages of D. sinensis after RNAi

Full size image

Positioning analysis of the CYP302A1 gene in D. sinensis

Whole mount in situ hybridization showed that the CYP302A1 gene in D. sinensis had six expression sites, which respectively located in the first antennal ganglion, ovary, cecae, olfactory hair, thoracic limb and tail spine (Fig. 7A). After RNAi, the expression signal of the CYP302A1 gene disappeared in the first antennal ganglion of D. sinensis, and the expression signal at the ovary was also greatly attenuated (Fig. 7B). Similarly, the expression sites of the CYP302A1 gene in D. sinensis was not detected in the negative control experiment (Fig. 7C).

Fig. 7
figure 7

Expression sites of the CYP302A1 gene in D. sinensis. Blue is the positive signal; A in situ hybridization map of D. sinensis without RNAi (antisense probe); B in situ hybridization map of D. sinensis after RNAi (antisense probe); C negative control (sense probe); D1: first antennal nerve; D2: ovary; D3: cecae; D4: olfactory hair; D5: thoracic limb; D6: tail spine

Full size image

Discussion

Ecdysone is synthesized under the catalyzation of a series of cytochrome P450 family coding enzymes in arthropods, which can regulate basic physiological processes such as molting and reproduction in arthropods [14, 29, 33]. The cytochrome P450 family is an ancient gene family that exists in almost all organisms [38, 39]. Although the amino acid sequences of the cytochrome P450 family member have high variability, a certain conservative domain are still found. In insects, conserved domains include helix-C, helix-I, helix-K, PERF and heme-binding [13]. In this study, the CYP302A1 gene of D. sinensis contained also the above five conserved domains, indicating that CYP302A1 gene belonged to the cytochrome P450 family.

In recent years, with the development of RNAi technology [40], RNAi has been widely used in the study of biological gene function [41, 42]. Using chitin synthase gene A (SeCHSA) as the target gene, the growth and development of Spodoptera exigua larvae fed by E. coli containing dsRNA of SeCHSA was disturbed, and then the mortality rates in the 5th instar larvae increased significantly [43]. After either feeding or injecting dsRNA of the sex-determining gene Transformer-2 to Zeugodacus scutellata, the Transformer-2 gene were all silenced, and increased significantly the number of male among their offspring [44]. Through RNAi to the appendage terminal Distal-less (Dll) gene of D. magna, it was found that the appendage terminal was deficient [45]. In this study, the expression levels of the CYP302A1 gene decreased significantly (knock-down of 68.34%) in the 5% E. coli treatment, whereas it was only knock-down of 23.32% in the 10% E. coli treatment, indicating that the silencing effect at the lower E. coli concentration was better than at higher concentration. This phenomenon was also observed in other Daphnia species [46, 47]. Through the feeding experiment on different concentrations of E. coli expressing the phenoloxidase dsRNA, Schumpert et al. (2015) found that the overall % with clear carapace (20%) at the end of the experiment of Daphnia melanica under higher concentration was lower than one (60%) under lower concentration [46]. After the 14-days feeding of dsRNA-Dhb2, Eytcheson and LeBlanc (2018) found also that the mRNA levels of Dhb2 of D. magna under higher E. coli concentration was significantly lower than one under lower concentration [47]. Therefore, it is likely that more bacteria consumption under higher E. coli concentration may have resulted in a decrease of dsRNA delivery and attenuation of siRNA suppression in D. sinensis. Moreover, the optimal concentration and time of silencing target genes can depend on different experimental animals or genes. After injecting dsRNAs of CYP307A2 and CYP314A1 genes, the development of the ovaries in female adults of Agasicles hygrophila delayed, and the egg production dropped significantly, and the expression level of vitellogenin gene (Vg) down-regulated significantly [48]. Similarly, when injected with dsRNA of the CYP315A1 gene, the adult ovary in Plutella xylostella became smaller and mature eggs decreased, and the cumulative number of eggs also decreased significantly [49]. In this study, the expression levels of the ecdysone receptor EcR gene and the USP gene in D. sinensis belonging to the downstream response genes of ecdysone decreased significantly after RNAi. Moreover, the knock-down of the CYP302A1 gene resulted in a significant decrease in the expression level of the downstream HR3 gene, but no significant effect on E75 gene was observed. During the experiment, the destruction of these downstream genes could result in some aborted eggs or dead embryos of D. sinensis in the incubation capsule. Hannas and Leblanc (2010) also found that the ecdysone could significantly affect the expression level of HR3 gene but less effect on E75 gene [50]. In this study, the knock-down of the CYP302A1 gene increased significantly the expression level of the FTZ-f1 gene in D. sinensis. Usually, FTZ-f1 is mainly responsible for regulating the expression of upstream CYP302A1, CYP306A1 and CYP315A1 genes in Drosophila ecdysone signal transduction [30]. Therefore, our results strongly supported that the CYP302A1 gene is an ecdysone synthesis pathway gene in D. sinensis, affecting the molting and reproduction of Daphnia.

Rewitz et al. (2006) found that the ecdysone synthesis pathway gene CYP302A1 of the tobacco hawkmoth was mainly expressed in the prethymocytes during the larval stage whereas it was detected in the fat body, midgut, ganglia, malpighian tubules and epidermis in animals after the fifth ecdysis [51]. In this study, the CYP302A1 gene in D. sinensis had mainly six expression sites, which located in the first antennal ganglion, ovary, cecae, olfactory hair, thoracic limb and tail spine. However, only expression signal of the CYP302A1 gene in the first antennal ganglion of D. sinensis disappeared after RNAi. Moreover, the expression signals in the ovary weakened greatly. Usually, the first antennae are the sites of signalling for the hormonal induction of reproduction of cladocera. Therefore, the CYP302A1 gene can be involved in the reproductive transformation of D. sinensis. It was also consistent with the aborted eggs or dead embryos in the incubation capsule of D. sinensis under the 5% E. coli concentration. Sumiya et al. (2014, 2016) found that both Neverland1 and CYP314A1 are involved in the synthesis of ecdysone in D. magna, and intestinal epithelial cells were responsible for this synthesis [25, 26]. Usually, the cecum is located in the left and right sides of the front end of the midgut in cladocera, with a pair of ear-like appendages. In this study, the expression site of the CYP302A1 gene at the cecae of D. sinensis is consistent with other studies [25, 26]. It was likely that the cecum in D. sinensis was an important synthesis and secretion site of ecdysone, and some sites of the thoracic limb and tail spine began to express the CYP302A1 gene during the ecdysis. In conclusion, the CYP302A1 gene in D. sinensis was a gene related to synthesis of the ecdysone, which would play an important role in the molting and reproduction of cladoceran.

Conclusions

Molting is an important physiological process in the life history of cladocera, which is mainly regulated by juvenile hormone and ecdysone. CYP302A1 is the key enzyme which plays a critical role in the synthesis of ecdysone of insects, but it has not been identified in cladocera. In this study, the CYP302A1 gene was also found in D. sinensis. The amino acid sequence analysis revealed that the CYP302A1 gene of D. sinensis had five characteristic conserved regions of cytochrome P450 family, namely, helix-C, helix-K, helix-I, PERF and heme-binding. In dsRNA mediated experiment, the expression level of the CYP302A1 gene decreased significantly in the 5% E. coli treatment. Meanwhile, the expression levels of EcR, USP and HR3 genes in the downstream decreased also significantly whereas that of FTZ-f1 gene increased significantly. Moreover, the development of embryos in the incubation capsule of D. sinensis appeared abnormal or disintegrated. The whole-mount in situ hybridization indicated that the CYP302A1 gene of D. sinensis had six expression sites (namely the first antennal ganglion, ovary, cecae, olfactory hair, thoracic limb and tail spine) before RNAi. However, the expression signal of the CYP302A1 gene of D. sinensis disappeared in the first antennal ganglion and obviously attenuated in the ovary after RNAi. Our results suggested that the CYP302A1 gene could play an important role in the ecdysone synthesis pathway of D. sinensis.

Materials and methods

D. sinensis culture

D. sinensis were obtained from the hatching of resting eggs in the sediments of Lake Chaohu, China. The individual was monoclonally cultured in an intelligent light incubator at 25 °C, with a 12 h:12 h light/dark cycle. The culture medium was changed every day, and D. sinensis were fed with 2 × 105 cells/mL of Tetradesmus obliquus. The culture medium was filtered and aerated tap water over 48 h.

RNA extraction and first-strand cDNA synthesis

50 female adults of D. sinensis were collected and stored in 100 μL RNAlater (Biosharp, Hefei, China) in 1.7 mL tubes, and total RNA were extracted by the MiniBEST universal RNA kit (TaKaRa, Dalian, China). The quality and purity of RNA was measured using a NanoDrop spectrophotometer (MD2000D, Biofuture, England) and Agarose electrophoresis. The first-strand cDNA was synthesized using the PrimeScript™RT kit (TaKaRa) according to the manufacturer’s instructions, and then stored at − 80 °C.

Sequence and phylogenetic analysis of CYP302A1 gene

The full-length CYP302A1 gene was obtained by sequencing, splicing and functional annotation of the D. sinensis transcriptome in our previous investigations [52]. The open reading frame of the nucleotide sequence of the CYP302A1 gene was analyzed using the online prediction tool ORF finder (https://0-www-ncbi-nlm-nih-gov.brum.beds.ac.uk/orffinder), and the amino acid sequence was obtained. The amino acid deduction analysis and alignment of the CYP302A1 gene were performed by DNAMAN software, and the phylogenetic tree was constructed by MAGA 11.0 software. Isoelectric point analysis were executed using ExPASy ProtParam (https://web.expasy.org/protparam). Signal peptide and transmembrane region in protein were respectively predicted using Signal 4.1 Server (http://www.cbs.dtu.dk/services/SignalP-4.1) and TMHMM (http://www.cbs.Dtu.dk/services/TMHMM).

Induced expression of dsRNA

The primers were designed according to the transcriptome data and EGFP (Enhanced Green Fluorescent Protein) plasmid sequence (Table 1). EGFP was used as a negative control [46, 53]. The PCR program was as follows: 95 °C for 3 min, 95 °C for 15 s, 55–60 °C for 15 s, and 72 °C for 40 s, followed by 35 cycles, and 72 °C for 5 min. PCR products were detected by a 1% agarose gel electrophoresis. PCR products of DIB/EGFP were subcloned into the pEASY-Blunt3 cloning vector (TransGen, Beijing, China) and sequenced (General Biol, Nanjing, China). After sequencing, the expression vectors L4440 and pEASY-Blunt3-DIB/EGFP plasmid were digested using restriction enzymes BamH I and Xho I (TaKaRa), and then ligated. The L4440 vector contains two T7 promoters which can be induced by isopropyl β-d-1-thiogalactopyranoside (IPTG) to produce dsRNA of the sequence ligated between these promoters. The L4440 constructs were transformed into E. coli DH5α cells (Sangon Biotech, Shanghai, China), and the vector was confirmed by sequencing (General Biol). After sequencing, the L4440-DIB plasmid was transformed into E. coli HT115 cells (a strain deficient in RNase III and an efficient production for dsRNAs). The transformed cells were cultured overnight in LB medium containing ampicillin (100 μg/mL, Sangon Biotech) and tetracycline (12.5 μg/mL, Sangon Biotech) for the CYP302A1 RNAi experiments. Isopropyl IPTG (1.0 mM, Sangon Biotech) was added to induce the T7 RNA polymerase and subsequent production of dsRNA of the target sequence. The expression of dsRNA was detected by 1% agarose gel electrophoresis. The primers used in the experiments were listed in Table 1.

Table 1 Names and sequences of primers used in the experiment
Full size table

RNAi feeding protocol

Four food treatments were selected for the experiments, namely, E5-EGFP: 5% dsRNA-EGFP + 95% T. obliquus; E5-DIB: 5% dsRNA-DIB + 95% T. obliquus; E10-EGFP: 10% dsRNA-EGFP + 90% T. obliquus; E10-DIB: 10% dsRNA-DIB + 90% T. obliquus. There were three replicates at each food treatment. Total food biomass was 20 mg/L wet weight. 15 animals (birth time < 12 h) in each replicate were employed as the mother. During the experiment, the culture medium at each food treatment was refreshed every day, and all newborns produced by the mother were immediately removed. All mothers in each replicate were collected at the twelfth day after feeding, placed in a 1.7 mL tube containing 100 μL RNAlater and stored in a refrigerator at 4℃ for 12 h, and then transferred to an ultra-low temperature refrigerator at − 80℃. After RNAi, the expression levels of related genes were determined by qPCR, and the relative expression levels of target genes was calculated by 2−△△Ct. The life history parameters of the four growth stages (at birth, at first brood, at first reproduction and at the twelfth days) were observed and recorded during the experiment.

Whole mount in situ hybridization

In order to prepare probes for in situ hybridization according to the ORF of the CYP302A1 gene, the sequences of specific primers were designed as follows: ISH-DIB-Forward: CGCGGATCCGAGCTTTATACTGTATCATCTTGCC, ISH-DIB-Reverse: CCGCTCGAGGACTCTTTTACTGCAGCCTTTAGAT, which the length of the amplicon is 150 bp. Target fragment was synthesized according to the primer sequence. After sequencing, the positive clone bacteria were amplified and cultured, and then the Blunt3-ISH-DIB vector plasmid was extracted. The concentration and purity of the plasmid were determined by a NanoDrop spectrophotometer (MD2000D, Biofuture). The linearized plasmid was obtained through restricted digestion of BamH I or Xho I, and the digested DNA fragments were purified and used as templates for sense and antisense probes, respectively. RNA probes were synthesized through DIG RNA Labeling Kit (SP6/SP7) (Roche, Mannheim, Germany), and then digested the probe cDNA template using DNase (RNase-free). Probe synthesis system (20 μL): linear plasmid ≤ 1 μg, 10 × NTP labeling mixture 2 μL, 10 × transcription buffer 1 μL, RNase Inhebitor 1 μL, RNA Polymerase SP6/T7 2 μL, and then added to 20 μL with RNase-free H2O. In addition, a 1/9 volume of 5 M LiCl and 2 volumes of absolute ethanol were added, and were incubated overnight at − 20 °C. RNA pellets was washed twice with 75% ethanol, and then dried to remove residual ethanol. Finally, RNA pellets was re-suspended in 30 μL diethylpyrocarbonate water, which 1 μL RNA inhibitor (20 U) were added. Aliquots of RNA solutions (1 µL) were added and electrophoresed, and the concentrations were measured. Remaining RNA probes were stored at − 20 °C.

According to the RNAi feeding protocol, 50 female adults of D. sinensis were collected. All samples were fixed in 4% paraformaldehyde (PFA) overnight, and then were replaced by anhydrous methanol and remained at − 20 °C. Whole-mount in situ hybridization was carried out according to previously published methods [36, 37] with some modifications. The specimens stored at − 20 °C were rehydrated gradually with methanol-PBST and digested with proteinase K (10 µg/mL, Solarbio, Beijing, China). The individuals were digested at 37 °C for 12 min. After pre-hybridization at 68 °C for 2.5 h, 100 µL RNA probe which was diluted 1:100 was added and incubated at 70 °C overnight. The specimens were blocked for approximately 2 h at room temperature with slow shaking in MAB block solution, and then added anti-DIG antibody (diluted 1:5000, Roche) and incubated at 4 °C for 13 h. Finally, antibody solution was discarded and the specimens were washed in MABT. At room temperature, the NBT liquid dye (Roche) was used to shade the color for 15 min − 2h, and then the individuals were fixed in 4% PFA for 20 min. Hybridization was observed with a fluorescence microscope (Olympus, CX21).

Availability of data and materials

All data generated or analyzed during this study included in the published article and its additional files.

References

  1. Jiang XZ, Du NS. Fauna sinica: Crustacean-freshwater Cladocera. Beijing: Science Press; 1979.

    Google Scholar 

  2. Li XG, Zhou G, Gu XH. Review of aquatic crustaceans molting and its influencing factors. Chin J Zool. 2014;49(2):294–302.

    CAS  Google Scholar 

  3. Loeb MJ. Hormonal control of growth and reproduction in the arthropods: introduction to the symposium. Am Zool. 1993;33:303–7.

    Article  Google Scholar 

  4. Mykles DL. Ecdysteroid metabolism in crustaceans. J Steroid Biochem Mol Biol. 2011;127(3–5):196–203.

    Article  CAS  Google Scholar 

  5. Li Z, Ge X, Ling L, Zeng BS, Xu J, Aslam AFM, You L, Palli SR, Huang YP, Tan AJ. CYP18A1 regulates tissue-specific steroid hormone inactivation in Bombyx mori. Insect Biochem Mol Biol. 2014;54:33–41.

    Article  Google Scholar 

  6. Kumar S, Chen D, Jang C, Nall A, Zheng XZ, Sehgal A. An ecdysone-responsive nuclear receptor regulates circadian rhythms in Drosophila. Nat Commun. 2014;5:5697.

    Article  CAS  Google Scholar 

  7. Wen R, Zhao Q, Wang B, Ma Y, Ma L. Molecular characterization and functional analysis of USP-1 by RNA interference in the Asian gypsy moth Lymantria dispar. J For Res. 2019;31(5):449–57.

    Google Scholar 

  8. Muramatsu M, Tsuji T, Tanaka S, Shiotsuki T, Jouraku A, Miura K, Mifom VI, Minakuchi C. Sex-specific expression profiles of ecdysteroid biosynthesis and ecdysone response genes in extreme sexual dimorphism of the mealybug, Planococcus kraunhiae (Kuwana). PLoS ONE. 2020;15(4): e0231451.

    Article  CAS  Google Scholar 

  9. Suzuki T, Iwami M. Sequential changes in the regulatory mechanism of carbohydrate digestion in larvae of the silkworm, Bombyx mori. J Comp Physiol B. 2021;191:439–53.

    Article  CAS  Google Scholar 

  10. Swall ME, Benrabaa S, Tran NM, Tran TD, Ventura T, Mykles DL. Characterization of Shed genes encoding ecdysone 20-monooxygenase (CYP314A1) in the Y-organ of the blackback land crab, Gecarcinus lateralis. Gener Comp Endocrinol. 2021;301: 113658.

    Article  CAS  Google Scholar 

  11. Niwa YS, Niwa R. Transcriptional regulation of insect steroid hormone biosynthesis and its role in controlling timing of molting and metamorphosis. Dev Growth Differ. 2016;58(1):94–105.

    Article  CAS  Google Scholar 

  12. Lin MT, Lu JH, Wang Y, Yuan DJ. Insect ecdysone-mediated molting and metamorphosis development. Chem Life. 2022;42(1):63–70.

    Google Scholar 

  13. Chavez VM, Marques G, Delbecque JP, Kobayashi K, Hollingsworth M, Burr J, Natzle JE, O’Connor MB. The Drosophila disembodied gene controls late embryonic morphogenesis and codes for a cytochrome P450 enzyme that regulates embryonic ecdysone levels. Development. 2000;127(19):4115–26.

    Article  CAS  Google Scholar 

  14. Warren JT, Petryk A, Marqués G, Jarcho M, Parvy JP, Dauphin-Villemant C, O’Connor MB, Gilbert LI. Molecular and biochemical characterization of two P450 enzymes in the ecdysteroidogenic pathway of Drosophila melanogaster. Proc Natl Acad Sci USA. 2002;99(17):11043–8.

    Article  CAS  Google Scholar 

  15. Petryk A, Warren JT, Marques G, Jarcho MP, Gilbert LI, Kahler J, Parvy JP, Li Y, Dauphin-Villemant C, O’Connor MB. Shade is the Drosophila P450 enzyme that mediates the hydroxylation of ecdysone to the steroid insect molting hormone 20-hydroxyecdysone. Proc Natl Acad Sci USA. 2003;100(24):13773–8.

    Article  CAS  Google Scholar 

  16. Niwa R, Matsuda T, Yoshiyama T, Namiki T, Mita K, Fujimoto Y, Kataoka H. CYP306A1, a cytochrome P450 enzyme, is essential for ecdysteroid biosynthesis in the prothoracic glands of Bombyx and Drosophila. J Biol Chem. 2004;279(34):35942–9.

    Article  CAS  Google Scholar 

  17. Warren JT, Petryk A, Marqués G, Parvy JP, Shinoda T, Itoyama K, Kobayashi J, Jarcho M, Li Y, O’Connor MB, Dauphin-Villemant C. Phantom encodes the 25-hydroxylase of Drosophila melanogaster and Bombyx mori: a P450 enzyme critical in ecdysone biosynthesis. Insect Biochem Mol Biol. 2004;34(9):991–1010.

    Article  CAS  Google Scholar 

  18. Yoshiyama T, Namiki T, Mita K, Kataoka H, Niwa R. Neverland is an evolutionally conserved rieske-domain protein that is essential for ecdysone synthesis and insect growth. Development. 2006;133(13):2565–74.

    Article  CAS  Google Scholar 

  19. Niwa R, Namiki T, Ito K, Shimada-Niwa Y, Kiuchi M, Kawaoka S, Kayukawa T, Banno Y, Fujimoto Y, Shigenobu S, Kobayashi S. Non-molting glossy/shroud encodes a short-chain dehydrogenase/reductase that functions in the “black box” of the ecdysteroid biosynthesis pathway. Development. 2010;137(12):1991–9.

    Article  CAS  Google Scholar 

  20. Yoshiyama-Yanagawa T, Enya S, Shimada-Niwa Y, Yaguchi S, Haramoto Y, Matsuya T, Shiomi K, Sasakura Y, Takahashi S, Asashima M, Kataoka H. The conserved rieske oxygenase daf-36/neverland is a novel cholesterol-metabolizing enzyme. J Biol Chem. 2011;286(29):25756–62.

    Article  CAS  Google Scholar 

  21. Yao TP, Segraves WA, Oro AE, McKeown M, Evans RM. Drosophila ultraspiracle modulates ecdysone receptor function via heterodimer formation. Cell. 1992;71(1):63–72.

    Article  CAS  Google Scholar 

  22. Hiruma K, Riddiford LM. Regulation of transcription factors MHR4 and betaFTZ-F1 by 20-hydroxyecdysone during a larval molt in the tobacco hornworm, Manduca sexta. Dev Biol. 2001;232(1):265–74.

    Article  CAS  Google Scholar 

  23. Zhu J, Li C, Sun G, Raikhel AS. The competence factor βFTZ-F1 potentiates ecdysone receptor activity via recruiting a p160/SRC coactivator. Mol Cell Biol. 2006;26(24):9402–12.

    Article  CAS  Google Scholar 

  24. Parvy JP, Blais C, Bernard F, Warren JT, Petryk A, Gilbert LI, O’Connor MB, Dauphin-Villemant C. A role for betaFTZ-F1 in regulating ecdysteroid titers during post-embryonic development in Drosophila melanogaster. Dev Biol. 2005;282(1):84–94.

    Article  CAS  Google Scholar 

  25. Sumiya E, Ogino Y, Miyakawa H, Hiruta C, Toyota K, Miyagawa S, Iguchi T. Roles of ecdysteroids for progression of reproductive cycle in the fresh water crustacean Daphnia magna. Front Zool. 2014;11(1):60.

    Article  Google Scholar 

  26. Sumiya E, Ogino Y, Toyota K, Miyakawa H, Miyagawa S, Iguchi T. Neverland regulates embryonic moltings through the regulation of ecdysteroid synthesis in the water flea Daphnia magna, and may thus act as a target for chemical disruption of molting. J Appl Toxicol. 2016;36(11–12):1476–85.

    Article  CAS  Google Scholar 

  27. Adhitama N, Kato Y, Matsuura T, Watanabe H. Roles of and cross-talk between ecdysteroid and sesquiterpenoid pathways in embryogenesis of branchiopod crustacean Daphnia magna. PLoS ONE. 2020;15(10): e0239893.

    Article  CAS  Google Scholar 

  28. Iga M, Smagghe G. Identification and expression profile of Halloween genes involved in ecdysteroid biosynthesis in Spodoptera littoralis. Peptides. 2010;31(3):456–67.

    Article  CAS  Google Scholar 

  29. Gilbert LI. Halloween genes encode P450 enzymes that mediate steroid hormone biosynthesis in Drosophila melanogaster. Mol Cell Endocrinol. 2004;215(1–2):1–10.

    Article  CAS  Google Scholar 

  30. Niwa R, Sakudoh T, Namiki T, Saida K, Fujimoto Y, Kataoka H. The ecdysteroidogenic P450 Cyp302a1/disembodied from the silkworm, Bombyx mori, is transcriptionally regulated by prothoracicotropic hormone. Insect Mol Biol. 2005;14(5):563–71.

    Article  CAS  Google Scholar 

  31. Wan PJ, Jia S, Li N, Fan JM, Li GQ. RNA interference depletion of the Halloween gene disembodied implies its potential application for management of planthopper Sogatellafurcifera and Laodelphaxstriatellus. PLoS ONE. 2014;9(1):e86675.

    Article  Google Scholar 

  32. Cheng DJ, Li ZQ, Meng M, Peng J, Qian WL, Kang LX, Xia QY. Characterization of cytochrome P450 genes involving in ecdysteroido genesis in Silkworm (Bombyx mori). Sci Agric Sin. 2014;47(3):594–604.

    CAS  Google Scholar 

  33. Rewitz KF, Gilbert LI. Daphnia Halloween genes that encode cytochrome P450s mediating the synthesis of the arthropod molting hormone: evolutionary implications. BMC Evol Biol. 2008;8:60.

    Article  Google Scholar 

  34. Cristescu MEA, Colbourne JK, Radivojac J, Lynch M. A microsatellite-based genetic linkage map of the waterflea, Daphnia pulex: on the prospect of crustacean genomics. Genomics. 2006;88(4):415–30.

    Article  CAS  Google Scholar 

  35. Routtu J, Jansen B, Colson I, De Meester L, Ebert D. The first-generation Daphnia magna linkage map. BMC Genomics. 2010;11(1):1–7.

    Article  Google Scholar 

  36. Liu A, Zhang M, Kong L, Wu D, Weng X, Wang D, Zhao Y. Cloning and expression profiling of a cuticular protein gene in Daphnia carinata. Dev Genes Evol. 2014;224(3):129–35.

    Article  CAS  Google Scholar 

  37. Kong L, Li HX, Wu DL, Xu GR, Wang DL, Zhao YL. Molecular characterization of the gene checkpoint homolog in Daphnia carinata during different reproductive phases. Genet Mol Res. 2016;15(2):1–13.

    Article  CAS  Google Scholar 

  38. Nelson DR. Metazoan cytochrome P450 evolution. Comp Biochem Physiol C Pharmacol Toxicol Endocrinol. 1998;121(1):15–22.

    Article  CAS  Google Scholar 

  39. Baldwin WS, Marko PB, Nelson DR. The cytochrome P450 (CYP) gene superfamily in Daphnia pulex. BMC Genomics. 2009;10:169.

    Article  Google Scholar 

  40. Matzke MA, Birchler JA. RNAi-mediated pathways in the nucleus. Nat Rev Genet. 2005;6(1):24–35.

    Article  CAS  Google Scholar 

  41. Hiruta C, Toyota K, Miyakawa H, Ogino Y, Miyagawa S, Tatarazako N, Shaw RJ, Iguchi T. Development of a microinjection system for RNA interference in the water flea Daphnia pulex. BMC Biotechnol. 2013;13(1):1–7.

    Article  Google Scholar 

  42. Shi M, Liu XN, Ma J. RNA interference of antifreeze protein gene in Tenebrio molitor mediated by bacterially expressed dsRNA. Biotechnol Bull. 2014;30(8):113–9.

    Google Scholar 

  43. Tian H, Peng H, Yao Q, Chen H, Xie Q, Tang B, Zhang W. Developmental control of a Lepidopteran pest Spodoptera exigua by ingestion of bacteria expressing dsRNA of a non-midgut gene. PLoS ONE. 2009;4(7): e6225.

    Article  Google Scholar 

  44. Al Baki M, Vatanparast M, Kim Y. Male-biased adult production of the striped fruit fly, Zeugodacus scutellata, by feeding dsRNA specific to Transformer-2. Insects. 2020;11(4): e211.

    Article  Google Scholar 

  45. Kato Y, Shiga Y, Kobayashi K, Tokishita SI, Yamagata H, Iguchi T, Watanabe H. Development of an RNA interference method in the cladoceran crustacean Daphnia magna. Dev Genes Evol. 2011;220:337–45.

    Article  CAS  Google Scholar 

  46. Schumpert CA, Dudycha JL, Patel RC. Development of an efficient RNA interference method by feeding for the microcrustacean Daphnia. BMC Biotechnol. 2015;15(1):1–3.

    Article  Google Scholar 

  47. Eytcheson SA, LeBlanc GA. Hemoglobin levels modulate nitrite toxicity to Daphnia magna. Sci Rep. 2018;8(1):1–8.

    Article  CAS  Google Scholar 

  48. Liu YR, Zhang H, Jin JS, Zhou ZS, Guo JY. Identification and expression analysis of the Halloween gene family in Agasicles hygrophila. Sci Agric Sin. 2020;53(10):2009–19.

    Google Scholar 

  49. Wang L. Identification and functional analysis of Halloween genes in Plutella xylostella. Fujian Agriculture and Forestry University; 2018.

  50. Hannas BR, Leblanc GA. Expression and ecdysteroid responsiveness of the nuclear receptors HR3 and E75 in the crustacean Daphnia magna. Mol Cell Endocrinol. 2010;315(1–2):208–18.

    Article  CAS  Google Scholar 

  51. Rewitz KF, Rybczynski R, Warren JT, Gilbert LI. Identification, characterization and developmental expression of Halloween genes encoding P450 enzymes mediating ecdysone biosynthesis in the tobacco hornworm, Manduca sexta. Insect Biochem Mol Biol. 2006;36(3):188–99.

    Article  CAS  Google Scholar 

  52. Wang ZY, Zhang FY, Jin QD, Wang YP, Wang WP, Deng DG. Transcriptome analysis of different life-history stages and screening of male-biased genes in Daphnia sinensis. BMC Genomics. 2022;23(1):1–11.

    Google Scholar 

  53. Xu LT, Xu SJ, Sun LW, Zhang YQ, Luo J, Bock R, Zhang J. Synergistic action of the gut microbiota in environmental RNA interference in a leaf beetle. Microbiome. 2021;9:98.

    Article  CAS  Google Scholar 

Download references

Acknowledgements

The L4440 vector and HT115 of E. coli were presented by Professor Liu Fengsong who came from Hebei University.

Funding

This work was supported by the Funds of the National Natural Science Fund of China (31870451, 31370470, 32001155).

Author information

Authors and Affiliations

  1. School of Life Science, Huaibei Normal University, Huaibei, 235000, People’s Republic of China

    Huiying Qi, Huijuan Cao, Yajie Zhao, Yaqin Cao, Qide Jin, Yeping Wang, Kun Zhang & Daogui Deng

Authors
  1. Huiying Qi
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Huijuan Cao
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Yajie Zhao
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Yaqin Cao
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Qide Jin
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Yeping Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Kun Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Daogui Deng
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

HYQ—Conceptualization, Methodology, Investigation, Writing-Original Draft, Writing and Editing. HJC, YJZ, YQC, QDJ, YPW: Validation, Data Curation. KZ: conception, revision of the manuscript. DDG: Revision, Review and Editing, Supervision, Project, Conceptualization, and Funding acquisition. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Daogui Deng.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Qi, H., Cao, H., Zhao, Y. et al. Cloning and functional analysis of the molting gene CYP302A1 of Daphnia sinensis. Front Zool 20, 2 (2023). https://0-doi-org.brum.beds.ac.uk/10.1186/s12983-023-00483-2

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/s12983-023-00483-2

Keywords

Frontiers in Zoology

ISSN: 1742-9994